View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11392_high_1_N (Length: 383)
Name: NF11392_high_1_N
Description: NF11392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11392_high_1_N |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 12 - 137
Target Start/End: Complemental strand, 55444 - 55319
Alignment:
| Q |
12 |
acaaagaatgcttaagttgaaggatgtccacctgaaggttcttccatgcgtattttaggttcccaattctcgattggtttttgctagacagttgaaaaac |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55444 |
acaaagaatgcttaagttgaaggatgtccacctgaaggttcttccataggtattttaggttcccaattctagattggtttttgctagacagttgaaaaac |
55345 |
T |
|
| Q |
112 |
tgtagaggatgcttcaattagccaat |
137 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
55344 |
tgtagaggatgcttcaattagccaat |
55319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 300 - 362
Target Start/End: Complemental strand, 55322 - 55260
Alignment:
| Q |
300 |
caatagttctataacatttgtgtttactactaccacaatttctattaaatataattgatgatg |
362 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55322 |
caatagttctataacatttgtgtttgctactaccacaatttctattaaatataattgatgatg |
55260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 103 - 210
Target Start/End: Complemental strand, 33755056 - 33754949
Alignment:
| Q |
103 |
ttgaaaaactgtagaggatgcttcaattagccaatgattttaactttcttacaaaaactattttgtagaatgtaacctttttaggacgcataagctgcaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||| |||| |||||||||| |||||||||||||| |
|
|
| T |
33755056 |
ttgaaaaactgtagaggatgcttcaattagccaaagattttaactttcttacaaaaactagtcggtaagttgtagcctttttagggcgcataagctgcaa |
33754957 |
T |
|
| Q |
203 |
atccatta |
210 |
Q |
| |
|
|| ||||| |
|
|
| T |
33754956 |
atacatta |
33754949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 33755139 - 33755084
Alignment:
| Q |
12 |
acaaagaatgcttaagttgaaggatgtccacctgaaggttcttccatgcgtatttt |
67 |
Q |
| |
|
||||||| | ||||||||||||| |||||||||||||||| |||||| ||||||| |
|
|
| T |
33755139 |
acaaagagtacttaagttgaagggtgtccacctgaaggttgttccatcggtatttt |
33755084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University