View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11393_high_5 (Length: 230)
Name: NF11393_high_5
Description: NF11393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11393_high_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 11527527 - 11527304
Alignment:
| Q |
7 |
tgttttcttctgttctttctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11527527 |
tgttttcttctgttctttctcaatttgaatttgcacctcatagattttgcatcgcaagacattgcaagcattttttgtaatacttgattgatgctttatt |
11527428 |
T |
|
| Q |
107 |
ttatacatgtataatgtaggaacgaaatatgtggacgcgtgtctgcaaatttgaaagagaaacagttcttttaagtttcaatatacagtgccctggttat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11527427 |
ttatacatgtataatgtaggaacgaaatatgtggatgcgtgtctgcaaatttgaaagagaaacagttctttcaagtttcaatatacagtgccctggttat |
11527328 |
T |
|
| Q |
207 |
aatattggtggcgataacaatttt |
230 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
11527327 |
aatattggcggcgataacaatttt |
11527304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University