View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11394_high_7 (Length: 319)
Name: NF11394_high_7
Description: NF11394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11394_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 36 - 293
Target Start/End: Original strand, 490102 - 490359
Alignment:
| Q |
36 |
tttttcttctttggtgttaacagcacgcctacaaacccttgcatccttatagattctgcctggtctgcagaagtagttcttttttggtgaacaatgacta |
135 |
Q |
| |
|
||||||||||| || |||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
490102 |
tttttcttcttaagttttaacatgaagcctacaaacccttgcatccttatagattctgcctggtctgcagaagtagttcttttttggtgaacaatgacta |
490201 |
T |
|
| Q |
136 |
tcttgtgagcatatacacaacccttccaatgcacatccatcttttaatattgtcaccccttctttaagtccaagcacttggtctgtccaatcactagaga |
235 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
490202 |
tcttttgagcatatacacaacccttccaatgcacatccatcttttaatattgtcaccccttctttaagtccaagcacttggtctgtccaatcactagaga |
490301 |
T |
|
| Q |
236 |
aaagtctcttcgggtcatatttctttttaaccttcaaaaacctatttgccttattata |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
490302 |
aaagtctcttcgggtcatatttctttttaaccttcaaaaacctatttgccttattata |
490359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 49016669 - 49016449
Alignment:
| Q |
19 |
agctcgtccttggtatgtttttcttctttggtgttaacagcacgcctacaaacccttgcatccttatagattctgcctggtctgcagaagtagttctttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| || ||||||||||| |||||||| | |||| |
|
|
| T |
49016669 |
agctcgtccttggtatgtttttcttcttaggtgttaacaccacgcctacaaacccttgcatccttataaatcctgcctggtctacagaagtaactgtttt |
49016570 |
T |
|
| Q |
119 |
ttggtgaacaatgactatcttgtgagcatatacacaacccttccaatgcacatccatcttttaatattgtcaccccttctttaagtccaagcacttggtc |
218 |
Q |
| |
|
| |||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49016569 |
tcggtgcacagtgagtatcttgtgagcatatacacaacccttccaatgcacatccatcttttaatattgtcaccccttctttaagtccaagcacttggtt |
49016470 |
T |
|
| Q |
219 |
tgtccaatcactagagaaaag |
239 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
49016469 |
tgtccactcactagagaaaag |
49016449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 127 - 275
Target Start/End: Complemental strand, 9072264 - 9072116
Alignment:
| Q |
127 |
caatgactatcttgtgagcatatacacaacccttccaatgcacatccatcttttaatattgtcaccccttctttaagtccaagcacttggtctgtccaat |
226 |
Q |
| |
|
||||| ||||||||||| || |||||||| ||||| |||||||| |||| ||| ||||||||||| |||||||| | |||||||||||| || ||||| |
|
|
| T |
9072264 |
caatggctatcttgtgaacaaatacacaaaccttctaatgcacacccatttttcaatattgtcacaccttcttttattccaagcacttgatccgtccatg |
9072165 |
T |
|
| Q |
227 |
cactagagaaaagtctcttcgggtcatatttctttttaaccttcaaaaa |
275 |
Q |
| |
|
|||||||||||||| | | |||||||||| ||||||||||||||| |
|
|
| T |
9072164 |
tactagagaaaagtccttgtgaatcatatttctctttaaccttcaaaaa |
9072116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University