View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11394_low_7 (Length: 326)
Name: NF11394_low_7
Description: NF11394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11394_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 163 - 313
Target Start/End: Original strand, 369972 - 370122
Alignment:
| Q |
163 |
aagtttcatgttagttcaaatacatgtgtaaactatatcaagattacaccgttggaccaagaaaaaagttaaacaaattatccagaaaagttcattattg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
369972 |
aagtttcatgttagttcaaatacatgtgtaaactatatcaagattacaccgttggaccaagaaaaaagttaaacaaattatccaaaaaagttcattattg |
370071 |
T |
 |
| Q |
263 |
annnnnnnnagtcatttgttctcacttctcagcaagggggctgatatattt |
313 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
370072 |
atttttattagtcatttgttctcacttctcagcaagggggctgctatattt |
370122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 9 - 117
Target Start/End: Original strand, 369852 - 369960
Alignment:
| Q |
9 |
agcataggatagcacatttagaaactttgatatcaggtttcagtgagaaaaatgctgtactgattcacttatgtttcttaacatatcaagtcagcagcag |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
369852 |
agcagaggatagcacatttagaaactttgatctcaggtttcagtgagaaaaatgctatactgattcacttatgtttcttaacatatcaagtcagcagcag |
369951 |
T |
 |
| Q |
109 |
ctttgaaat |
117 |
Q |
| |
|
||||||||| |
|
|
| T |
369952 |
ctttgaaat |
369960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University