View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11395_high_20 (Length: 252)
Name: NF11395_high_20
Description: NF11395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11395_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 16684744 - 16684502
Alignment:
| Q |
11 |
cagagacctcagttacttcagggaggcttgcaggaaggatgcgtacgagtgatcgggcactcgaggaaagtttgagcttcagcatttgcaagaagataat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16684744 |
cagagacctcagttacttcagggaggcttgcaggaaggatgcgtacgagtgatcgggcactcgaggaaagtttgagcttcagcatttgcaagaagataat |
16684645 |
T |
|
| Q |
111 |
ccaggtaagctatataacatttgttgtgtatgtctcaagagttcagttatacaccgattttcttcattattgacattttatctataatgcttcaaaatat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
16684644 |
ccaggtaagctatataacatttgttgtgtatgtctcaagagttcagttatacaccgattttcttcattattaacattttatctctaatgcttcaaaatat |
16684545 |
T |
|
| Q |
211 |
attcgttaaagg--atctttttctgcattgtttcactataaaa |
251 |
Q |
| |
|
|| | |||||| || |||||||||||||||||||||||||| |
|
|
| T |
16684544 |
atcggataaaggatatttttttctgcattgtttcactataaaa |
16684502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University