View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11395_low_16 (Length: 280)
Name: NF11395_low_16
Description: NF11395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11395_low_16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 25 - 280
Target Start/End: Complemental strand, 38829885 - 38829630
Alignment:
| Q |
25 |
tccccataattcctcatgtcgtttgcaaccgtcattacccgaccaaaataatcagtgattgattcaccctgcttcattgctaagacctcaaagtctcggc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829885 |
tccccataattcctcatgtcgtttgcaaccgtcattactcgaccaaaataatcagtgattgattcaccctgcttcattgctaagacctcaaagtctcggc |
38829786 |
T |
|
| Q |
125 |
gtagacgattgagctgtgctctcttcactcgagcattgccgcgacacttcaacttcatggaatcccatagctgtttagatgtctccttctgcgtgatggt |
224 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | || |
|
|
| T |
38829785 |
gtagatgattgagttgtgctctcttcactcgagcattgtcgcgacacttcaacttcatggaatcccatagccgtttagatgtctccttctgcgtgttcgt |
38829686 |
T |
|
| Q |
225 |
cttcagaattgacttgtcaattgactgaaacaagtaattcttagccttcgaatcct |
280 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
38829685 |
cttcagaattgacttgtcaattaactgaaacaagtaattcttagccttcaaatcct |
38829630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University