View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11395_low_23 (Length: 249)
Name: NF11395_low_23
Description: NF11395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11395_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 231
Target Start/End: Original strand, 2935953 - 2936167
Alignment:
| Q |
17 |
ctaatccattcgaggatttagtatgtttaaaggttgtctcttttgtacgtctaagtcagaaattcaactcatagtccgcaaacataaaggactcaaatta |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2935953 |
ctaatccattcgaggatttagcatgtttaaaggttgtctcttttgtacgtctaagtcagaaattcaactcatagtccgcaaacataaaggactcaaatta |
2936052 |
T |
|
| Q |
117 |
cttatcatttgaactatacaagtttggtcctctccaatttcagtacaacagccttaaaacatgaaaagaaacaattgtaaaagattattaatgtttaggt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
2936053 |
cttatcatttgaactatacaagtttggtcctctccaatttcagtacaacagccttaaaacatgaaaagaaacaattgtaaaggtttattaatgtttaggt |
2936152 |
T |
|
| Q |
217 |
tagttgggatgggat |
231 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2936153 |
tagttgggatgggat |
2936167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University