View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11396_high_41 (Length: 240)
Name: NF11396_high_41
Description: NF11396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11396_high_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 14427209 - 14427285
Alignment:
| Q |
1 |
agaaaattgaactaacacatttagttatgtaaattaactatcaaagtacccataatgacattttcacacgtacacaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14427209 |
agaaaattgaactaacacatttagttatgtaaattaactatcaaagtacccacaatgacattttcacacgtacacaa |
14427285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 74
Target Start/End: Original strand, 14417165 - 14417224
Alignment:
| Q |
14 |
aacacatttagttatgtaaattaactatcaaagtacccataatgacattttcacacgtaca |
74 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
14417165 |
aacacatttagttatgtaaaacaactatcatagta-tcataatgacattttcacatgtaca |
14417224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 224
Target Start/End: Original strand, 14417297 - 14417375
Alignment:
| Q |
146 |
ttttactttcaaataaccatagaaagtgacattttttaaaatagatataacactgggaaatgcatgtgacctactcaac |
224 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||| ||| | ||||||| | |||||| |||||| || ||||| |
|
|
| T |
14417297 |
ttttactttcaaataactataggaagtgacattatttaatataaacataacacatgaaaatgcgtgtgacatattcaac |
14417375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University