View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11396_low_35 (Length: 276)
Name: NF11396_low_35
Description: NF11396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11396_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 18 - 262
Target Start/End: Complemental strand, 609507 - 609281
Alignment:
| Q |
18 |
gagagtgaagtgaaaatggagaggtatgagaggggaagtagaagaaggagatgcaaagaaggtaaacatgaaaacaatgaaaggttgggaaattggggtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
609507 |
gagagtgaagtgaaaatggagaggtatgagaggggaagtagaagaaggagatgcaaagaaggtaaacatgaaaacaatgaaaggttgggaaattggggtg |
609408 |
T |
|
| Q |
118 |
aacctctttggcttgcattggcaacttcttgaaaactctcatttggatctttgtctctctatctattatttaacaatgatcatgtaaaacaannnnnnnn |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
609407 |
aacctctttggcttgcattggcaacttcttgaaaactctcatttg------------------aattatttaacaatgatcatgtaaaacaatttttttt |
609326 |
T |
|
| Q |
218 |
agaatttttaggtatctgttctttttcttctgaatatcccctttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
609325 |
agaatttttaggtatctgttctttttcttctgaatatcccttttg |
609281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University