View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11396_low_40 (Length: 256)
Name: NF11396_low_40
Description: NF11396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11396_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 237
Target Start/End: Original strand, 32243436 - 32243662
Alignment:
| Q |
11 |
cagagagcaggagacagaggatataccgttcatcttgtgattggcatggcagggcaagacaagcaatccatctggaaaacaagaccgggtcatcccaatg |
110 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243436 |
cagagagcaagagacaaaggatataccgttcatcttgtgattggcatggcagggcaagacaagcaatccatctggaaaacaagaccgggtcatcccaatg |
32243535 |
T |
|
| Q |
111 |
actcgatctttccacaaccaaaacggtctttgtatcgtgggggtgaatttgggtacattagactagtggctacaaagcagaagctcgtggtttcttatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243536 |
actcgatctttccacaaccaaaacggtctttgtatcgtgggggtgaatttgggtacattagactagtggctacaaagcagaagctcgtggtttcttatgt |
32243635 |
T |
|
| Q |
211 |
tggaaatcatgatggcgaggtgcatga |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32243636 |
tggaaatcatgatggcgaggtgcatga |
32243662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 33 - 237
Target Start/End: Original strand, 32248539 - 32248743
Alignment:
| Q |
33 |
ataccgttcatcttgtgattggcatggcagggcaagacaagcaatccatctggaaaacaagaccgggtcatcccaatgactcgatctttccacaaccaaa |
132 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||| |||| ||| | ||||||||| ||||||| ||| | | |||| |||||||||||| |
|
|
| T |
32248539 |
ataccattcatcttgtgatcggcatggcagggcaagactggcaacccatgtggcgaccaagaccggatcatcccgatgtcccaatctatccacaaccaaa |
32248638 |
T |
|
| Q |
133 |
acggtctttgtatcgtgggggtgaatttgggtacattagactagtggctacaaagcagaagctcgtggtttcttatgttggaaatcatgatggcgaggtg |
232 |
Q |
| |
|
||| |||||||| || |||||||| || || ||||||||| | |||||||||||||||| |||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
32248639 |
acgatctttgtaccgcgggggtgagttcggatacattagattgatggctacaaagcagaatctcgtgatttcttatgttggtaatcatgatggcgaggtg |
32248738 |
T |
|
| Q |
233 |
catga |
237 |
Q |
| |
|
||||| |
|
|
| T |
32248739 |
catga |
32248743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University