View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11396_low_48 (Length: 237)
Name: NF11396_low_48
Description: NF11396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11396_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 53274014 - 53274217
Alignment:
| Q |
16 |
gaaggcatttcttgcaagcaataaatgagtgaaaaaattaagctgaaaagaaaagggagggaagaaagagtgagcatttgcaag---tagctaaacttat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
53274014 |
gaaggcatttcttgcaagcaataaatgagtgaaaaaattcagctgaaaag-----ggagggaagaaagagtgagcatttgcaagaagtagctagacttat |
53274108 |
T |
 |
| Q |
113 |
tcttcaatgtgtaccttgatgatttgtttcttcatattattgggagttgtttcttacacaactaaggctagtttggcaacactagagcttccaccaaatg |
212 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53274109 |
tcttcaatgtgtaccttaatgatttatttcttcatattattgggagttgtttcttacacaactaaggctagtttggcaacaatagagcttccaccaaatg |
53274208 |
T |
 |
| Q |
213 |
tttcatttc |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
53274209 |
tttcatttc |
53274217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University