View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11396_low_52 (Length: 226)

Name: NF11396_low_52
Description: NF11396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11396_low_52
NF11396_low_52
[»] chr5 (1 HSPs)
chr5 (79-209)||(18053575-18053705)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 79 - 209
Target Start/End: Complemental strand, 18053705 - 18053575
Alignment:
79 tatcgaccaactttatgagccccgcatcgcgagatatgaaaatcatacaaggtgtttgccattgtctaccttgcttcgcaagctatgagcccaacattgt 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||    
18053705 tatcgaccaactttatgagccccgcatcgcgagatatgaaaatcatacaaggtgttcgccattgtctaccttggttcgcaagctatgagcccaacattgt 18053606  T
179 gactatactgagtgtcaggacaagggattca 209  Q
    |||||||||||||||||||||||||||||||    
18053605 gactatactgagtgtcaggacaagggattca 18053575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University