View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11396_low_52 (Length: 226)
Name: NF11396_low_52
Description: NF11396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11396_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 79 - 209
Target Start/End: Complemental strand, 18053705 - 18053575
Alignment:
| Q |
79 |
tatcgaccaactttatgagccccgcatcgcgagatatgaaaatcatacaaggtgtttgccattgtctaccttgcttcgcaagctatgagcccaacattgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18053705 |
tatcgaccaactttatgagccccgcatcgcgagatatgaaaatcatacaaggtgttcgccattgtctaccttggttcgcaagctatgagcccaacattgt |
18053606 |
T |
 |
| Q |
179 |
gactatactgagtgtcaggacaagggattca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18053605 |
gactatactgagtgtcaggacaagggattca |
18053575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University