View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11397_high_2 (Length: 425)
Name: NF11397_high_2
Description: NF11397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11397_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 18 - 412
Target Start/End: Complemental strand, 18468466 - 18468073
Alignment:
| Q |
18 |
gtttccggtgctggtggttttgtaggatttagaccagtttgcggtctttgacttggcgatctgcagtttgttcatgaaacccatatgggtcttttttaac |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18468466 |
gttttcggtgctggtggttttgtaggatttagaccagtttgcggtctttgacttggcgatctgcagtttgttcatgaaacccatatgggtcttttc-aac |
18468368 |
T |
|
| Q |
118 |
tacttcttctcctttatggcggtagccgatggttttgcttaactttcaaggattgggtgattgttgctgtattcggcaatagcggtccgatttgggggcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18468367 |
tacttcttctcctttatggcggtagccgatggttttgcttaactatcaaggattgggtgattgttgctgtattcggcaacagcggtccgatttgggggcc |
18468268 |
T |
|
| Q |
218 |
ttcagttttcgtcgatccatctcgctcgttgtgtttggtggttcattgcgttgatgaaggttgtattggatggttttcaaatatagaaagaggcaaagtg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468267 |
ttcagttttcgtcgatccatctcgctcgttgtgtttggtggttcattgcgttgacgaaggttgtattggatggttttcaaatatagaaagaggcaaagtg |
18468168 |
T |
|
| Q |
318 |
ccgtcgtgaatctcaactcatggtggttttggtgtttgctttggttgttataacaatatttcttaaagtttcaggttgtcacttgattgttctct |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18468167 |
ccgtcgtgaatctcaactcatggtggttttggtgtttgctttggttgttataacaatatttcttaaagtttcaggttgtcacttgattgttctct |
18468073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 86 - 235
Target Start/End: Complemental strand, 22460925 - 22460775
Alignment:
| Q |
86 |
tgttcatgaaacccatatgggtcttttttaactacttcttctcctttatggcggtagccgatggttttgcttaactttcaaggattgggtgatt-gttgc |
184 |
Q |
| |
|
|||||| ||||||| |||||| || ||| ||| |||| | ||||| |||| ||||| | |||||||| || |||||||||||||||| || ||||| |
|
|
| T |
22460925 |
tgttcaagaaacccttatgggcctatttcaacaacttttggtccttaatggtggtagtcattggttttgattgtgtttcaaggattgggtgctttgttgc |
22460826 |
T |
|
| Q |
185 |
tgtattcggcaatagcggtccgatttgggggccttcagttttcgtcgatcc |
235 |
Q |
| |
|
| | | ||||||| |||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
22460825 |
tatctctagcaatagtggtccgatctggcggccttcatttttcgtcgatcc |
22460775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University