View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11398_high_4 (Length: 282)
Name: NF11398_high_4
Description: NF11398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11398_high_4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 9 - 282
Target Start/End: Complemental strand, 5479291 - 5479014
Alignment:
| Q |
9 |
tgctttaggaatccatggtggatcagtcatccggacgcgagaacagtggtaaacacaaacaaaagaaagttgaatgagtgtagggatttcgcacaatgcg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5479291 |
tgctttaggaatccatggtggatcagtcatccggacgcgagaacaatagtaaacacaaacaaaagaaagttgaatgagtgtagggatttcgcacaatgcg |
5479192 |
T |
 |
| Q |
109 |
atagggttgtgccagctttgatagtatctcataccagcattcattggagacggtggaagaagcttttacatatagtttactcgtcaaagcttcgaaaaga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5479191 |
atagggttgtgccagctttgatagtatctcataccagcattcgttggagaaggtggaagaagcttttacatatagtttactcgtcaaagcttcgaaaaga |
5479092 |
T |
 |
| Q |
209 |
taactttttactactgcaacg----nnnnnnnnnatcaattttaaagttttaaaatattctttaacttgtttttcata |
282 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5479091 |
taactttttactactgcaacgtttttttttttttatcaattttaaagttttaaaatattctttaacttgtttttcata |
5479014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University