View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11398_high_5 (Length: 240)

Name: NF11398_high_5
Description: NF11398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11398_high_5
NF11398_high_5
[»] chr8 (1 HSPs)
chr8 (1-234)||(5478588-5478821)


Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 5478821 - 5478588
Alignment:
1 catcaagccattatttgtgacaaatgcatgttatgacgcattggaaacggggcacccttcacccacagtgacaaacggcagagttaagggactactataa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||    
5478821 catcaagccattatttgtgacaaatgcatgttatgacgcattggaaacggggcacccttcatccacagtgacaaacggcagagttaagggattactataa 5478722  T
101 gcaagaactttgcttagttacttgcactattggggattccggaaaaatatgtggtgactttatgattcgtgtgcctctctattcttctaacacattactt 200  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5478721 gcaagaactttgcttagttacttgcactattgggtattccggaaaaatatgtggtgactttatgattcgtgtgcctctctattcttctaacacattactt 5478622  T
201 tgcttccattatttctagaccacctctctgcttc 234  Q
    ||||||||||||||||||||||||||| ||||||    
5478621 tgcttccattatttctagaccacctctttgcttc 5478588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University