View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_119 (Length: 315)
Name: NF1139_high_119
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_119 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 13298823 - 13298577
Alignment:
| Q |
1 |
catgagattgaccgattttgtaaattgagagacgctaatgactgtgaaaagttgtttgtttatttatttcaataatttaacagtccatgtatatatgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13298823 |
catgagattgaccgattttgtaaattgagagacgctaatgactgtgaaaaattgtttgtttatttatttcaataatttaacagtccatttatatatgtga |
13298724 |
T |
 |
| Q |
101 |
aaattgtatggatactgaacctattttgttgcacctcgatgaactagtcttcgtgaaccaacctttctatctttttcttgcttttagaggcaaggg-tcg |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
13298723 |
aaattgtatggatactgaacttattttgttgcacctcgatgaactagtcttcttgaaccaacctttctatctttttcttgcttttagaggcaagggctcg |
13298624 |
T |
 |
| Q |
200 |
tcctcgtggtcatcattatcaagaaatttcgacttcaggcgggcatc |
246 |
Q |
| |
|
| ||| ||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
13298623 |
tactcatggtcatcattatcaagaaattttggcttcaggcgggcatc |
13298577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University