View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_144 (Length: 277)
Name: NF1139_high_144
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_144 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 30 - 261
Target Start/End: Original strand, 24491758 - 24491984
Alignment:
| Q |
30 |
tttggatcatggctcagctcatcatccctctttacctaatcaacaagcatatcatgcttcttaagttcgttataactaacttgctccttttgtattggct |
129 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24491758 |
tttggatcatggctcagctcat---ccctctttacctaatcaacaagcatatcatgcttcttaagttcgttataactaacttgctccttttgtattggct |
24491854 |
T |
 |
| Q |
130 |
atatatataaagccttgtgatgagtagatttaagagagttaagtggatgaattctgatcaaactttttagctagaattgagtgtgcacatatcaggagat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24491855 |
atatatataaagccttgtgatgagtagatttaagggagttaagtggatgaattctgatcaaactttttagctagaattga--gtgcacatatcaggagac |
24491952 |
T |
 |
| Q |
230 |
gaaaattcaatttctgagagatggcattgcta |
261 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
24491953 |
gaaaattcaatttgtgagagatggcattgcta |
24491984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University