View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_148 (Length: 259)
Name: NF1139_high_148
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_148 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 152 - 259
Target Start/End: Complemental strand, 45104401 - 45104294
Alignment:
| Q |
152 |
ttggttcctgcagaatatctcatttgacaaagacattacgatatataaatactgaagtttgaactttagattttccgcatatttatcttaagtaaatttc |
251 |
Q |
| |
|
|||||| | ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45104401 |
ttggttacagcagaatatctcagttgacaaagacattgcgatatataaatactgaagtttgaactttagattttccgcttatttatcttaagtaaatttc |
45104302 |
T |
|
| Q |
252 |
caatttct |
259 |
Q |
| |
|
|||||||| |
|
|
| T |
45104301 |
caatttct |
45104294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 30 - 90
Target Start/End: Complemental strand, 45104523 - 45104463
Alignment:
| Q |
30 |
tctctcagaatgataatgacagtatctctgttgaaacagagtttagcagaatgcatacggt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45104523 |
tctctcagaatgataatgacagtatctctgttgaaacagagtttagcagaatgcatacggt |
45104463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University