View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_159 (Length: 253)
Name: NF1139_high_159
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_159 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 40182079 - 40181831
Alignment:
| Q |
11 |
cataggttagagttcaacattctcaatcgctcagtaaacctaaacctagccgtgtgtgtgccgtttgtctccaaccgattctcactcgcaaactatatat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40182079 |
cataggttagagttcaacattctcaatcgctcagtaaacctaaacctagccgtgtgtgtgccgtctgtctccaaccgattctcactcgcaaactatatat |
40181980 |
T |
 |
| Q |
111 |
aagaagatgtgggtgtcgtttgcagcaagatatggcaggaactacatcacttcttctt------cttcctcctcatcatcatccacacgaagaattccta |
204 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40181979 |
atgcagatgtgggtgtcgtttgcagcaagatatggcaggaactacatcacttcttcttcttcttcttcctccttatcatcatccacacgaagaattccta |
40181880 |
T |
 |
| Q |
205 |
accctaacaaggtcattttctccaactttctaagtcaatcatcatcatc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40181879 |
accctaacaaggtcattttctccaactttctaagtcaatcatcatcatc |
40181831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University