View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_163 (Length: 252)
Name: NF1139_high_163
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_163 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 11 - 252
Target Start/End: Original strand, 25743604 - 25743847
Alignment:
| Q |
11 |
ttattctcatgacaaagttggtagttatcatgttgnnnnnnnattagttagtcttgaattgttgtca---ccatctttgtcccaaaaagaagaagttatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25743604 |
ttattctcatgacaaagttggtagttatcatgttgtttttttattagttagtcttgaattgttgtcatcaccatctttgtcccaaaaagaagaagttatc |
25743703 |
T |
 |
| Q |
108 |
actgtnnnnnnnngtaatgtactgaattgacaacggcagtaagagtactgtctttttccggtgtgcaagagtatcgaacctatgcccctagcgttgaaag |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25743704 |
actgtaaaaaaa-gtaatgtactgaattgacaacggcagtaagagtactgtctttttccggtgtgcaagagtaacgaacctatgcccctagcgttgaaag |
25743802 |
T |
 |
| Q |
208 |
gtagattttcaatctagtgattttaggataactgacttgtctttt |
252 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25743803 |
gtagattttcaatcaagtgattctaggataactgacttgtctttt |
25743847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University