View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_185 (Length: 249)
Name: NF1139_high_185
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_185 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 2 - 157
Target Start/End: Complemental strand, 9394489 - 9394334
Alignment:
| Q |
2 |
tggcaactgtgtttttatgttattttgtttgattttatgttgagaattttctgctttagggtttattcatatgatttcgtgttgaaaattgggttttagt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394489 |
tggcaactgtgtttttatgttattttgtttgattttatgttgaaaattttcttctttagggtttattcatatgatttcgtgttgaaaattgggttttagt |
9394390 |
T |
|
| Q |
102 |
gtttatttcttttattgcatgttggaaattctgtttctattttaattatgttgaaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9394389 |
gtttatttcttttattgcatgttggaaattctgtttctattttatttatgttgaaa |
9394334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 189 - 238
Target Start/End: Complemental strand, 9394314 - 9394265
Alignment:
| Q |
189 |
atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394314 |
atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcat |
9394265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 1342003 - 1341951
Alignment:
| Q |
16 |
ttatgttattttgtttgattttatgttgagaattttctgctttagggtttatt |
68 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| | ||||||||||||| |
|
|
| T |
1342003 |
ttatgttattttgtttgattttatgttcaaaattttgttttttagggtttatt |
1341951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 44
Target Start/End: Complemental strand, 31943936 - 31943907
Alignment:
| Q |
15 |
tttatgttattttgtttgattttatgttga |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31943936 |
tttatgttattttgtttgattttatgttga |
31943907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University