View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_high_185 (Length: 249)

Name: NF1139_high_185
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_high_185
NF1139_high_185
[»] chr5 (2 HSPs)
chr5 (2-157)||(9394334-9394489)
chr5 (189-238)||(9394265-9394314)
[»] chr7 (1 HSPs)
chr7 (16-68)||(1341951-1342003)
[»] chr6 (1 HSPs)
chr6 (15-44)||(31943907-31943936)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 2 - 157
Target Start/End: Complemental strand, 9394489 - 9394334
Alignment:
2 tggcaactgtgtttttatgttattttgtttgattttatgttgagaattttctgctttagggtttattcatatgatttcgtgttgaaaattgggttttagt 101  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
9394489 tggcaactgtgtttttatgttattttgtttgattttatgttgaaaattttcttctttagggtttattcatatgatttcgtgttgaaaattgggttttagt 9394390  T
102 gtttatttcttttattgcatgttggaaattctgtttctattttaattatgttgaaa 157  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
9394389 gtttatttcttttattgcatgttggaaattctgtttctattttatttatgttgaaa 9394334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 189 - 238
Target Start/End: Complemental strand, 9394314 - 9394265
Alignment:
189 atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcat 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
9394314 atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcat 9394265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 1342003 - 1341951
Alignment:
16 ttatgttattttgtttgattttatgttgagaattttctgctttagggtttatt 68  Q
    ||||||||||||||||||||||||||| | |||||| |  |||||||||||||    
1342003 ttatgttattttgtttgattttatgttcaaaattttgttttttagggtttatt 1341951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 44
Target Start/End: Complemental strand, 31943936 - 31943907
Alignment:
15 tttatgttattttgtttgattttatgttga 44  Q
    ||||||||||||||||||||||||||||||    
31943936 tttatgttattttgtttgattttatgttga 31943907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University