View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_high_187 (Length: 244)

Name: NF1139_high_187
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_high_187
NF1139_high_187
[»] chr5 (1 HSPs)
chr5 (167-206)||(8361837-8361876)


Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 206
Target Start/End: Original strand, 8361837 - 8361876
Alignment:
167 caccacagaacaaagttacttgcagttaggaaagaaaagg 206  Q
    ||||||||||| ||||||||||||||||||||||||||||    
8361837 caccacagaaccaagttacttgcagttaggaaagaaaagg 8361876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University