View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_191 (Length: 238)
Name: NF1139_high_191
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_191 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 54 - 229
Target Start/End: Complemental strand, 12105159 - 12104984
Alignment:
| Q |
54 |
taaatatatagggttaaaattactttattttatttttagtttaactcaaccgacaaagttgatattgttactagtgcagcggagttcaaaacctagatct |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12105159 |
taaatatatagggttaaaattactttattttatttttagtttaactcaaccgacaaagttgatattgttaccagtgcagcggagttcaaaacctagatct |
12105060 |
T |
 |
| Q |
154 |
cgcttttgtgtgtgaattttgaatagtatttgtcaattcgtctacagatgttatatagattatctcaaagtattat |
229 |
Q |
| |
|
||||||| | ||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||| |
|
|
| T |
12105059 |
cgcttttatttgtgagttttgaatagtatttgtcaattcgtctatagatgttatatagattatctcgaagttttat |
12104984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 12105637 - 12105597
Alignment:
| Q |
1 |
ggagatcatgaaagatgagagtgagatgttgaataatgaga |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12105637 |
ggagatcatgaaagatgagagtgagatgttgaataatgaga |
12105597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University