View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_high_196 (Length: 228)

Name: NF1139_high_196
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_high_196
NF1139_high_196
[»] chr7 (1 HSPs)
chr7 (7-228)||(46062872-46063093)
[»] chr1 (1 HSPs)
chr1 (119-171)||(39205157-39205209)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 46063093 - 46062872
Alignment:
7 tgtttgatatgtttatcattagtataaatataatattaatgtaggtaccaatgtgaagataccttctcttccgcccagtgttgtgattctctcccctaat 106  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||    
46063093 tgtttgatatgttcatcattagtataaatataatattaatgtaggtaccaatgtgaagataccttctcttccgcccagtgtagtaattctctcccctgat 46062994  T
107 aactttgataaggttgtcttagatgaaacaaaagatgtcatggtggagttctatgcaccatggtaaatatataatcatgttctgctattatcttttttca 206  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46062993 aactttgataaggttgtcttagatgaaacaaaagatgtcctggtggagttctatgcaccatggtaaatatataatcatgttctgctattatcttttttca 46062894  T
207 tatactttatgatgtgataata 228  Q
    ||||||||||||| ||||||||    
46062893 tatactttatgatatgataata 46062872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 171
Target Start/End: Original strand, 39205157 - 39205209
Alignment:
119 gttgtcttagatgaaacaaaagatgtcatggtggagttctatgcaccatggta 171  Q
    |||||||| |||||||| ||||||||| |||| ||||| ||||||||||||||    
39205157 gttgtcttggatgaaaccaaagatgtcttggttgagttttatgcaccatggta 39205209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University