View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_208 (Length: 211)
Name: NF1139_high_208
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_208 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 8437008 - 8437127
Alignment:
| Q |
1 |
caagaattagtcgagggtgcttacaaactagagtgagacttcaaattcgtagaattcaatgcccc-aaatattgctatttttgtgaagatggtttggaga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8437008 |
caagaattagtcgagggtgcttacaaactagagtgagacttcaaattcgtagaattcaatgccccaaaatattgctatttttgtgaagatggtttggaga |
8437107 |
T |
 |
| Q |
100 |
atgatctgcaagtgttggtt |
119 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8437108 |
atgatctgcaagtgttggtt |
8437127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 122 - 201
Target Start/End: Complemental strand, 35967273 - 35967194
Alignment:
| Q |
122 |
tgatgtattttgtgtcgctatgttgttttcttgaacttggttgatggatactttttaaatcctttccttacccatattgt |
201 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |||| |
|
|
| T |
35967273 |
tgatgtattttgtgtcactatcttgttttcttgaacttggttgatggatattttttgaatcatttccttacccattttgt |
35967194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University