View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_high_93 (Length: 365)
Name: NF1139_high_93
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_high_93 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 337
Target Start/End: Original strand, 30600988 - 30601324
Alignment:
| Q |
1 |
ctatctatgcccatcatctaattctaagttatgactatctcacttattgttttttcttagtttctttttcggtctctcatcccaacctgattttcttgct |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30600988 |
ctatctctgcccatcatctaattctaagttatgactatctcacttattgttttttcttagtttctttttctgtctctcatcccaacctgattttcttgct |
30601087 |
T |
 |
| Q |
101 |
attggaggtgcatgaacgagaggatcctggttcaaaaggaatgtgaaacttatagggcaattttcaagaataaggcctgacatcatgctgtctctgtgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30601088 |
attggaggtgcatgaacgagaggatcctggttcaaaaggaatgtgaaacttatagggcaattttcaagaataaggcctgacatcatgctgtatctgtgaa |
30601187 |
T |
 |
| Q |
201 |
tctattattggtgcaaacacatggatctacgtatatataactcggtgttattagtaacacactacgtatatacaattgctactataaaagacgagttatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
30601188 |
tctattattggtgcaaacacatggatcaacgtatatataactcggtgttattagtaacacactacgtatatataattgctgctataaaagacgagttatt |
30601287 |
T |
 |
| Q |
301 |
tatttatttttatcttggattttgtccagttatttat |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30601288 |
tatttatttttatcttggattttgtccagttatttat |
30601324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University