View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_102 (Length: 375)
Name: NF1139_low_102
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_102 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 7 - 266
Target Start/End: Complemental strand, 52169054 - 52168795
Alignment:
| Q |
7 |
cctagctgttgcatggagccctgatggaaaacgacttgcttgtggctcaatggatggcaccatttctgtttttgatgtgcaacgagccaaatttttgcat |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52169054 |
cctatctgttgcatggagccctgatggaaaacgacttgcttgtggctcaatggatggcaccatttctgtttttgatgtgcaacgagccaaatttttgcat |
52168955 |
T |
|
| Q |
107 |
caccttgaaggccacttcatgcctgtgcgttctcttgtttattctccttatgatccgaggctactgttttcagcttcagatgatggtaatgttcacatgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52168954 |
caccttgaaggccacttcatgcctgtgcgttctcttgtttattctccttatgatccaaggctactgttttcagcttcagatgatggtaatgttcacatgt |
52168855 |
T |
|
| Q |
207 |
atgatgctgagggaaaagccttagttgggaccatgtcaggacatgctagttgggttttat |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52168854 |
atgatgctgagggaaaagccttagttgggaccatgtcaggacatgctagttgggttttat |
52168795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 265 - 375
Target Start/End: Complemental strand, 11824105 - 11823995
Alignment:
| Q |
265 |
atatatggatcctctccatctgcaacttttggagcatttttagctgttttctttgacacagcatatgtcatttgaactgaaccacctccaaggtcaatta |
364 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||| ||| ||||||| ||||||| ||||||||| || ||||||||||| || |||| |
|
|
| T |
11824105 |
atatatggatcatctccatcagcaacttttggagcatttttagctgtattccttgacactgcatatgccatttgaaccgatccacctccaagatccatta |
11824006 |
T |
|
| Q |
365 |
ctcccactgtt |
375 |
Q |
| |
|
||||||||||| |
|
|
| T |
11824005 |
ctcccactgtt |
11823995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 262 - 375
Target Start/End: Complemental strand, 32935076 - 32934963
Alignment:
| Q |
262 |
tttatatatggatcctctccatctgcaacttttggagcatttttagctgttttctttgacacagcatatgtcatttgaactgaaccacctccaaggtcaa |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32935076 |
tttatatatggatcctctccatctgcaacttttggagcatttttagctgttttctttgacacagcatatgtcatttgaactgaaccacctccaaggtcaa |
32934977 |
T |
|
| Q |
362 |
ttactcccactgtt |
375 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32934976 |
ttactcccactgtt |
32934963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 268 - 375
Target Start/End: Complemental strand, 32911963 - 32911856
Alignment:
| Q |
268 |
tatggatcctctccatctgcaacttttggagcatttttagctgttttctttgacacagcatatgtcatttgaactgaaccacctccaaggtcaattactc |
367 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||| || ||||||| |
|
|
| T |
32911963 |
tatggatcaactccatcagcaacttttggagcatttttagctgttttctttgacactgcatatgccatttgaactgatccacctccaagatccattactc |
32911864 |
T |
|
| Q |
368 |
ccactgtt |
375 |
Q |
| |
|
|||||||| |
|
|
| T |
32911863 |
ccactgtt |
32911856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 268 - 375
Target Start/End: Complemental strand, 32923963 - 32923856
Alignment:
| Q |
268 |
tatggatcctctccatctgcaacttttggagcatttttagctgttttctttgacacagcatatgtcatttgaactgaaccacctccaaggtcaattactc |
367 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||| | ||||||||| ||||||| |||||||||||| ||||||||||| || ||||||| |
|
|
| T |
32923963 |
tatggatcttctccatcagcaacttttggagcatttttagctgtatactttgacactgcatatgccatttgaactgatccacctccaagatccattactc |
32923864 |
T |
|
| Q |
368 |
ccactgtt |
375 |
Q |
| |
|
|||||||| |
|
|
| T |
32923863 |
ccactgtt |
32923856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University