View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_108 (Length: 362)
Name: NF1139_low_108
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_108 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 2 - 157
Target Start/End: Complemental strand, 9394489 - 9394334
Alignment:
| Q |
2 |
tggcaactgtgtttttatgttattttgtttgattttatgttgagaattttctgctttagggtttattcatatgatttcgtgttgaaaattgggttttagt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394489 |
tggcaactgtgtttttatgttattttgtttgattttatgttgaaaattttcttctttagggtttattcatatgatttcgtgttgaaaattgggttttagt |
9394390 |
T |
 |
| Q |
102 |
gtttatttcttttattgcatgttggaaattctgtttctattttaattatgttgaaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9394389 |
gtttatttcttttattgcatgttggaaattctgtttctattttatttatgttgaaa |
9394334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 189 - 351
Target Start/End: Complemental strand, 9394314 - 9394152
Alignment:
| Q |
189 |
atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcatttctttgatttggtgatggaaattatgnnnnnnnnnnnnngattcatgtt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9394314 |
atggttcattggtttgaatttcatgttgaaaactgtgttttatggttcatttctttgatttggtgatggaaattatgttttttattttttgattcatgtt |
9394215 |
T |
 |
| Q |
289 |
aaaattttggttctaggttcctttcttttgatttaatgttgaaaattgtgtttttggattcat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9394214 |
gaaattttggttctaggttcctttcttttgatttaatgttgaaaattgtgtttttggattcat |
9394152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 210 - 265
Target Start/End: Complemental strand, 9394066 - 9394011
Alignment:
| Q |
210 |
catgttgaaaactgtgttttatggttcatttctttgatttggtgatggaaattatg |
265 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||| |||| |||||| |
|
|
| T |
9394066 |
catgttgaaaactgtgttttaggattcatttctttgatttggtgttggagattatg |
9394011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 265
Target Start/End: Complemental strand, 9394184 - 9394125
Alignment:
| Q |
206 |
atttcatgttgaaaactgtgttttatggttcatttctttgatttggtgatggaaattatg |
265 |
Q |
| |
|
|||| |||||||||| |||||||| | |||||||||||||||||||| ||||||||||| |
|
|
| T |
9394184 |
atttaatgttgaaaattgtgtttttggattcatttctttgatttggtgttggaaattatg |
9394125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 351
Target Start/End: Complemental strand, 9394108 - 9394038
Alignment:
| Q |
281 |
ttcatgttaaaattttggttctaggttcctttcttttgatttaatgttgaaaattgtgtttttggattcat |
351 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||| |||||| |||||||||| |||||||| |||||||| |
|
|
| T |
9394108 |
ttcatgttgaaaatttggttttaggttccttttatttgataccatgttgaaaactgtgttttaggattcat |
9394038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 1342003 - 1341951
Alignment:
| Q |
16 |
ttatgttattttgtttgattttatgttgagaattttctgctttagggtttatt |
68 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| | ||||||||||||| |
|
|
| T |
1342003 |
ttatgttattttgtttgattttatgttcaaaattttgttttttagggtttatt |
1341951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 244
Target Start/End: Complemental strand, 31943688 - 31943650
Alignment:
| Q |
206 |
atttcatgttgaaaactgtgttttatggttcatttcttt |
244 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31943688 |
atttcatgttgaaaaatgtgttttagggttcatttcttt |
31943650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 15 - 44
Target Start/End: Complemental strand, 31943936 - 31943907
Alignment:
| Q |
15 |
tttatgttattttgtttgattttatgttga |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31943936 |
tttatgttattttgtttgattttatgttga |
31943907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University