View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_118 (Length: 347)
Name: NF1139_low_118
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_118 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 3e-67; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 30 - 171
Target Start/End: Complemental strand, 24134927 - 24134786
Alignment:
| Q |
30 |
agtaggccctatgagtgcaaatagggtcaatgaagaatatgatacaacatcaattgttcaacttccatctctaaggtaaagttttgtttgatattatcta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24134927 |
agtaggccctatgagtgcaaatagggtcaatgaagaatatgatacaacatcaattgttcaacttccatctctaaggtaaaattttgtttgatattatcta |
24134828 |
T |
|
| Q |
130 |
taacttggtataatttcaaaattatttatccatggtattttt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24134827 |
taacttggtataatttcaaaattatttacacatggtattttt |
24134786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 30 - 108
Target Start/End: Complemental strand, 19757046 - 19756968
Alignment:
| Q |
30 |
agtaggccctatgagtgcaaatagggtcaatgaagaatatgatacaacatcaattgttcaacttccatctctaaggtaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19757046 |
agtaggccctatgagtgcaaatagggtcgctgaagaatatgatacaacatcaattgttcaacttcaatctctaaggtaa |
19756968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 191 - 257
Target Start/End: Complemental strand, 24134368 - 24134302
Alignment:
| Q |
191 |
ttattttattttattcagtacctttaaaaacaatttcaatttttaatatttcactttcatatgtata |
257 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24134368 |
ttattttattttattcagtacccttaaaaacaatttcaatttttaatatttcactttcatatgtata |
24134302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 261
Target Start/End: Complemental strand, 19756558 - 19756529
Alignment:
| Q |
232 |
tttaatatttcactttcatatgtataatat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19756558 |
tttaatatttcactttcatatgtataatat |
19756529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University