View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_122 (Length: 345)
Name: NF1139_low_122
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_122 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 30 - 333
Target Start/End: Original strand, 7608092 - 7608395
Alignment:
| Q |
30 |
taatctcccttcataatggatagttattaacatgtacatcatgtatatttaaaacttcattctgtcttgcagtttaagggaggctccatcttctcagtta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7608092 |
taatctcccttcataatggatagttattaacatgtacatcatgtatatttaaaacttcattctgtcttgcagtttaagggaggctccatcttctcagtta |
7608191 |
T |
 |
| Q |
130 |
agatcagatggtcccagaaaatattatttcacgatggcgagttctgtcttaacatccctttctgctttcctaaatatgtcaaccctgttggaagatcaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7608192 |
agatcagatggtcccagaaaatattatttcacgatggcgagttctgtcttaacatccctttctgctttcctaaatatgtcaaccctgttggaagatcaat |
7608291 |
T |
 |
| Q |
230 |
ttctaagaaagagaagatatttttgaaattgaattctggaactgcaaatgaagtgttatgcaaagcaaccagccatcctcttaaggtaaaacatatcaca |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7608292 |
ttctaagaaagagaagatatttttgaaattgaattctggaactgcaaatgaagtgttatgcaaagcaaccagccatcctcttaaggtaaaacatatcaca |
7608391 |
T |
 |
| Q |
330 |
tatt |
333 |
Q |
| |
|
|||| |
|
|
| T |
7608392 |
tatt |
7608395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University