View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_139 (Length: 317)
Name: NF1139_low_139
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_139 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 30 - 303
Target Start/End: Original strand, 38570792 - 38571065
Alignment:
| Q |
30 |
ctaatcactcaccaaataaattcatgaacaacacatcttaattccattgctttctctccctcatcttcatctcatcctcttctttctgaaaatagcataa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38570792 |
ctaatcactcaccaaataaattcatgaacaacacatcttaattccattgctttctctccctcatcttcatctcatcctcttctttctgaaaatagcataa |
38570891 |
T |
|
| Q |
130 |
acctttctctcctcacttcactctaaatccattcataccaaacaattaatcctgcaaaataaataaatggctcttgctggttctgaagtagagcttaaag |
229 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38570892 |
acctttctctccttacttcactctaaatccattcataccaaacaattaatcctgcaaaataaataaatggctcttgctggttctgaagtagagcttaaag |
38570991 |
T |
|
| Q |
230 |
ttcaagctatgaataagaagaaaactactatttcaagaagctggattttgctagaccgtgatggtagagatata |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38570992 |
ttcaagctatgaataagaagaaaactactatttcaagaagctggattttgctagaccgtgatggtagagatata |
38571065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University