View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_142 (Length: 313)
Name: NF1139_low_142
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_142 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 3 - 304
Target Start/End: Complemental strand, 29038199 - 29037874
Alignment:
| Q |
3 |
aattactagtatatgggaatgtatttggaattttatgcaattagacacta---tcatatcttgttt---------gtgtttacttctgtgtgatcataaa |
90 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29038199 |
aattactagtatatgtgaatgtatttggaattttatgcaattagacactaatatcatatcttgttttgattgtttgtgtttacttctgtgtgatcataaa |
29038100 |
T |
|
| Q |
91 |
gcaatttttcttcttggtcaaaacctatatatacattaagtttggtctgattagtgtctatatcaggttatgtaaatgcattcctag------------- |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29038099 |
gcaatttttcttcttggtcaaaacctatatagacattaagtttggtctgattagtgtctatatcaggttatgtaaatgcattcctaggaactatattatc |
29038000 |
T |
|
| Q |
178 |
ttgaatagcactaatacaggattcttttgaacaatatatttggttcattgacaggaatcttctataaaactacatatatatgannnnnnnncttcttcta |
277 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
29037999 |
ttgaataacactaatacaggattcttttgaacaatatatttggttcattgacaggaatcttttataaaactacatatatatgatttttttt-ttcttcta |
29037901 |
T |
|
| Q |
278 |
aatcacaaatgttggtgttatattgtt |
304 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
29037900 |
aatcacaaatgttggtgttattttgtt |
29037874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University