View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_153 (Length: 300)
Name: NF1139_low_153
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_153 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 29 - 287
Target Start/End: Original strand, 26966721 - 26966979
Alignment:
| Q |
29 |
agtaaaaactcaccannnnnnngcatcaggttcatcttcacaaaactgatcatggtcaccaccagatttatgagaagtctgctcaaattcatcatctccg |
128 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26966721 |
agtaaaaactcaccatttttttgcatcaggttcatcttcacaatactgatcatgatctccaccagatttatgagaagtctgctcgaattcatcatctcca |
26966820 |
T |
|
| Q |
129 |
atcgatatcgatgaattctccggtgtagcaaccaaatccatttgaatttcatttccaaaatgatttgaaggaggaggatttgccagtgacgacgacgatg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
26966821 |
atcgatatcgatgaattctccggtgtagcaaccaaatccatttgaatttcatttccaaaatgatttgaaggaggaggatttgcatgtgacaacgacgatg |
26966920 |
T |
|
| Q |
229 |
aagacatcgagtttgtgttcctcttgttagccacaggcttaggatgattatgactacct |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26966921 |
aagacatcgagtttgtgttcctcttgttagccacaggcttaggatgattatgactacct |
26966979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University