View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_168 (Length: 279)
Name: NF1139_low_168
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_168 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 7 - 260
Target Start/End: Original strand, 29789748 - 29790001
Alignment:
| Q |
7 |
gtatcatagggtagcctttaatccggggaaataaaaaatattgaatgggtcatgcatcgttttctaatttatgagtgacgtacaagttgcacatgcaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789748 |
gtatcatagggtagcctttaatccggggaaataaaaaatattgaatgggtcatgcatcgttttctaatttatgagtgacgtacaagttgcacatgcaatt |
29789847 |
T |
|
| Q |
107 |
gaaagtgaccctttaaatagaacataacagcaaatctaaatctcacttatgatgcttggtttgtttaaccattgtaagcaaacaatcatattaatctact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789848 |
gaaagtgaccctttaaatagaacataacagcaaatctaaatctcacttatgatgcttggtttgtttaaccattgtaagcaaacaatcatattaatctact |
29789947 |
T |
|
| Q |
207 |
ttaattaattgttcatgtgcaacataccccacgtcgtgcatcttgccttccaac |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29789948 |
ttaattaattgttcatgtgcaacataccccacgtcgtgcatcttgccttccaac |
29790001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University