View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_194 (Length: 252)
Name: NF1139_low_194
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_194 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 49 - 252
Target Start/End: Original strand, 41416836 - 41417039
Alignment:
| Q |
49 |
ctttgtatttaatatttattgtttggatttatcttctctcgtggcgtaaatagaatttaatttataagaattgactaggaatattttttggtcatatcat |
148 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41416836 |
ctttatatttaatatttattgtttggatttatcttctctcgtggcgtaaatataatttaatttataagaattgactaggaatattttttggtcatatcat |
41416935 |
T |
|
| Q |
149 |
ttgtcatcgtcaaatttccacctaccattttttacttgattctccttcaaagaaagaaaaaacaatctgtgtttggttagagtacatgaatggatggaag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41416936 |
ttgtcatcgtcaaatttccacctaccattttttacttgattctccttcaaagaaagaaaaaacaatctgtgtttggttagagtacatgaatggatggaag |
41417035 |
T |
|
| Q |
249 |
actt |
252 |
Q |
| |
|
|||| |
|
|
| T |
41417036 |
actt |
41417039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University