View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_206 (Length: 251)
Name: NF1139_low_206
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_206 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 109 - 243
Target Start/End: Original strand, 29292012 - 29292146
Alignment:
| Q |
109 |
gcttcaactagatatgaactttagtttaagtgcttcgataccaaataaaactaattgctgagggctaataacttgagaaataaaattactttgaccccat |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29292012 |
gcttcacctagatatgaactttagtttaagtgcttcgataccaaataaaactaattgctgagggctaataacttgagaaataaaattactttgaccccat |
29292111 |
T |
 |
| Q |
209 |
tgatttttcagctagcattgcattgtattcatctc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
29292112 |
tgatttttcagctagcattgcattgtattcctctc |
29292146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 29291860 - 29291955
Alignment:
| Q |
1 |
aggaaataaaattaaagttggtaaaggtttacaacacacacattattattttatcatcatatagaagacattgagaaccattagttaacttttgat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29291860 |
aggaaataaaattaaagttggtaaaggtttacaatacacacattattattttatcatcatatagaagacaatgagaaccattagttaacttttgat |
29291955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University