View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_220 (Length: 239)
Name: NF1139_low_220
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_220 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 49700421 - 49700651
Alignment:
| Q |
1 |
acaacgtatacttgtttaagggagtgtcaaaagacctaatttttcaattggtaatattttctttttggttatcctttgatttgatttgacaaaaactgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49700421 |
acaacgtatacttgtttaagggagtgtcaaaagacctaatttttcaattggtaatattttctttttggttatcctttgatttgatttgacaaaaactgag |
49700520 |
T |
 |
| Q |
101 |
atcgtatgtgataaaacttaggtctgtgatcagtgagcatctttcggtatttggtaatcaataagtctcactagagagcnnnnnnnnnnnnnnnntgaga |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
49700521 |
atcgtatgtgataaaactttggtctgtgatcagtgagcatctttcggtatttggtaatcaataagtttcactagagagcaaaaagaaaataaaaatgaga |
49700620 |
T |
 |
| Q |
201 |
cagactctttcttcacatgtttatattgttg |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
49700621 |
cagactctttcttcacatgtttattttgttg |
49700651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University