View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_low_225 (Length: 235)

Name: NF1139_low_225
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_low_225
NF1139_low_225
[»] chr2 (1 HSPs)
chr2 (18-103)||(35967194-35967279)


Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 35967279 - 35967194
Alignment:
18 agtttgtgatgtattttgtgtcgctatgttgttttcttgaacttggttgatggatactttttaaatcctttccttacccatattgt 103  Q
    |||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||| |||| ||||||||||||| ||||    
35967279 agtttgtgatgtattttgtgtcactatcttgttttcttgaacttggttgatggatattttttgaatcatttccttacccattttgt 35967194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University