View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_238 (Length: 228)
Name: NF1139_low_238
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_238 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 46063093 - 46062872
Alignment:
| Q |
7 |
tgtttgatatgtttatcattagtataaatataatattaatgtaggtaccaatgtgaagataccttctcttccgcccagtgttgtgattctctcccctaat |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| || |
|
|
| T |
46063093 |
tgtttgatatgttcatcattagtataaatataatattaatgtaggtaccaatgtgaagataccttctcttccgcccagtgtagtaattctctcccctgat |
46062994 |
T |
|
| Q |
107 |
aactttgataaggttgtcttagatgaaacaaaagatgtcatggtggagttctatgcaccatggtaaatatataatcatgttctgctattatcttttttca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46062993 |
aactttgataaggttgtcttagatgaaacaaaagatgtcctggtggagttctatgcaccatggtaaatatataatcatgttctgctattatcttttttca |
46062894 |
T |
|
| Q |
207 |
tatactttatgatgtgataata |
228 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
46062893 |
tatactttatgatatgataata |
46062872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 171
Target Start/End: Original strand, 39205157 - 39205209
Alignment:
| Q |
119 |
gttgtcttagatgaaacaaaagatgtcatggtggagttctatgcaccatggta |
171 |
Q |
| |
|
|||||||| |||||||| ||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
39205157 |
gttgtcttggatgaaaccaaagatgtcttggttgagttttatgcaccatggta |
39205209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University