View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_low_245 (Length: 222)

Name: NF1139_low_245
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_low_245
NF1139_low_245
[»] chr4 (1 HSPs)
chr4 (1-36)||(50633541-50633576)


Alignment Details
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 50633541 - 50633576
Alignment:
1 tagacaatattttgagttttatctaatatatagtag 36  Q
    |||| |||||||||||||||||||||||||||||||    
50633541 tagataatattttgagttttatctaatatatagtag 50633576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University