View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_253 (Length: 210)
Name: NF1139_low_253
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_253 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 8437032 - 8436966
Alignment:
| Q |
1 |
tgtaagcaccctcgactaattcttgaatttaagttacgaaccttaaggggtactttaacacaccaaa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437032 |
tgtaagcaccctcgactaattcttgaatttaagttacgaaccttaaggggtactttaacacaccaaa |
8436966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 65 - 118
Target Start/End: Original strand, 8437074 - 8437127
Alignment:
| Q |
65 |
aaatattgctatttttgtgaagatggtttggagaatgatctgcaagtgttggtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437074 |
aaatattgctatttttgtgaagatggtttggagaatgatctgcaagtgttggtt |
8437127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 121 - 200
Target Start/End: Complemental strand, 35967273 - 35967194
Alignment:
| Q |
121 |
tgatgtattttgtgtcgctatgttgttttcttgaacttggttgatggatactttttaaatcctttccttacccatattgt |
200 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |||| |
|
|
| T |
35967273 |
tgatgtattttgtgtcactatcttgttttcttgaacttggttgatggatattttttgaatcatttccttacccattttgt |
35967194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University