View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_low_253 (Length: 210)

Name: NF1139_low_253
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_low_253
NF1139_low_253
[»] chr1 (2 HSPs)
chr1 (1-67)||(8436966-8437032)
chr1 (65-118)||(8437074-8437127)
[»] chr2 (1 HSPs)
chr2 (121-200)||(35967194-35967273)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 8437032 - 8436966
Alignment:
1 tgtaagcaccctcgactaattcttgaatttaagttacgaaccttaaggggtactttaacacaccaaa 67  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8437032 tgtaagcaccctcgactaattcttgaatttaagttacgaaccttaaggggtactttaacacaccaaa 8436966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 65 - 118
Target Start/End: Original strand, 8437074 - 8437127
Alignment:
65 aaatattgctatttttgtgaagatggtttggagaatgatctgcaagtgttggtt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8437074 aaatattgctatttttgtgaagatggtttggagaatgatctgcaagtgttggtt 8437127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 121 - 200
Target Start/End: Complemental strand, 35967273 - 35967194
Alignment:
121 tgatgtattttgtgtcgctatgttgttttcttgaacttggttgatggatactttttaaatcctttccttacccatattgt 200  Q
    |||||||||||||||| |||| |||||||||||||||||||||||||||| ||||| |||| ||||||||||||| ||||    
35967273 tgatgtattttgtgtcactatcttgttttcttgaacttggttgatggatattttttgaatcatttccttacccattttgt 35967194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University