View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1139_low_254 (Length: 209)

Name: NF1139_low_254
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1139_low_254
NF1139_low_254
[»] chr4 (1 HSPs)
chr4 (1-129)||(21640992-21641120)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 21640992 - 21641120
Alignment:
1 gtatctcgtgtaaccttgttttgctgaagaagcaaaggctttgattgattgttttctctcttataatttatcttataacaaacctatattcattaatgta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||    
21640992 gtatctcgtgtaaccttgttttgctgaagaagcaaaggctttgattgattgttttctctcttataatttatcttttaacaaacctatactcattaatgta 21641091  T
101 cgtatgatcactttcatttcattccatcc 129  Q
    |||||||||||||||||||||||||||||    
21641092 cgtatgatcactttcatttcattccatcc 21641120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University