View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_257 (Length: 205)
Name: NF1139_low_257
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_257 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 40276544 - 40276369
Alignment:
| Q |
1 |
atcacttccaatgaagtgcttatgattaattccacaaaccctttctttcttcgtttccttcaagatcttcaagcgcggcttcctcattctaatagttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40276544 |
atcacttccaatgaagtgcttatgattaattccacaaaccctttctttcttcgtttccttcaagatcttcaagcgcggcttcctcattctaatagttcta |
40276445 |
T |
|
| Q |
101 |
ataatatccaaattgccaataatgtggatggtgattatgaagcgaaaactttgttcgatgattctcctaacaatgc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40276444 |
ataatatccaaattgccaataatgtggatggtgattatgaagcgaaaactttgttcgatgattctcctaacaatgc |
40276369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 39625264 - 39625193
Alignment:
| Q |
1 |
atcacttccaatgaagtgcttatgattaattccacaaaccctttctttcttcgtttccttcaagatcttcaa |
72 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||||||||||| |||| || ||||||||||||||| |
|
|
| T |
39625264 |
atcacttcgaatgaagtgcttatgattaattcaattgaccctttctttattcgctttcttcaagatcttcaa |
39625193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 39634814 - 39634743
Alignment:
| Q |
1 |
atcacttccaatgaagtgcttatgattaattccacaaaccctttctttcttcgtttccttcaagatcttcaa |
72 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||||||||||| |||| || ||||||||||||||| |
|
|
| T |
39634814 |
atcacttcgaatgaagtgcttatgattaattcaattgaccctttctttattcgctttcttcaagatcttcaa |
39634743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University