View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_40 (Length: 492)
Name: NF1139_low_40
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 8e-56; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 8e-56
Query Start/End: Original strand, 236 - 354
Target Start/End: Complemental strand, 33397993 - 33397875
Alignment:
| Q |
236 |
gcccgtgcaaaacgcgattgcaaaactttatttttcaatgattaattcatctttatataagcaacaaaactttagcatagtcttcatcttttccctctca |
335 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33397993 |
gcccgtgtaaaacgcgattgcaaaactttatttttcaatgattaattcatctttatataagcaacaaaactttagcatagtcttcatcttttccctctca |
33397894 |
T |
 |
| Q |
336 |
ttgcaaaaatcccgaactc |
354 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
33397893 |
ttgcaaaaatccagaactc |
33397875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 61 - 154
Target Start/End: Complemental strand, 33398164 - 33398072
Alignment:
| Q |
61 |
taacagtagcactctgctatttttaaaatgagctcgtggactgcgtggtgaacagatctcatccatgcatgtttgtaccatagccaagtgttag |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33398164 |
taacagtagcactctgctatttttaaaatgagctcgtggactgcgtggtgaacagatctcatccatgcatg-ttgtaccatagccaagtgttag |
33398072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 7 - 42
Target Start/End: Complemental strand, 33398215 - 33398180
Alignment:
| Q |
7 |
tccaagaaaataaaacattagcactctgctttagtc |
42 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33398215 |
tccaaaaaaataaaacattagcactctgctttagtc |
33398180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 89; Significance: 1e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 379 - 488
Target Start/End: Complemental strand, 43509270 - 43509159
Alignment:
| Q |
379 |
tactgtaaatgtactcactcaactatcttctttataaaaaa--tggatctctctcgttgactaagattatgtgcaattttaaattcaattgtagaactgt |
476 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43509270 |
tactgtaaatgtactcagtcaaatatcttctttataaaaaaaatggatcactctcgttgactaagattatgtgcaattttaaattcaattgtagaactgt |
43509171 |
T |
 |
| Q |
477 |
tactaattatct |
488 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43509170 |
tactaattatct |
43509159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University