View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_55 (Length: 438)
Name: NF1139_low_55
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_55 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 86 - 434
Target Start/End: Original strand, 12275895 - 12276239
Alignment:
| Q |
86 |
gacaaaacattgttcatttgtgttctatgtggctctcttaaacccttttcggtcagtaggttccatcaactccggatttttcagatcaagtttcttgttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12275895 |
gacaaaacattgttcatttgtgttctttgtggctctcttaaacccttttcggt----aggttccatcaactccggattttccagatcaagtttcttgttt |
12275990 |
T |
|
| Q |
186 |
caaattcgttctcaaatctagtttgtccttcacggaatctcctttcctccttcataactcgcaccaattttgtggtgttgttggtcctagttttctaggg |
285 |
Q |
| |
|
||||| ||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12275991 |
taaatttgttctcaaatctagtttgtcctttagggaatctccttgcctccttcataactcgcaccaattttgtggtggtgtaggtcctagttttctaggt |
12276090 |
T |
|
| Q |
286 |
gaccagtatgtgattgttgtttactcaagcatggtttgttgttcccaatcacagtgagtagttggttgtggaaccgtgatcgtgtaggcgaacggtttca |
385 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||| |||| |
|
|
| T |
12276091 |
gactagtatgtgattgttgtttactcaagcatggtttgttgttcccaatcacagtgagtagttggttttggaaccgtgattgtgttggcgaacgggttca |
12276190 |
T |
|
| Q |
386 |
ccgccattatgcaaagagttaagtttgtatgaatttgcctttgcttctt |
434 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
12276191 |
ccgccattatgcaaagagttaagtttgtatgaatttgtctttggttctt |
12276239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University