View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_82 (Length: 396)
Name: NF1139_low_82
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_82 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 3e-98; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 189 - 386
Target Start/End: Complemental strand, 39187803 - 39187606
Alignment:
| Q |
189 |
ccgagttttacatgaacaagcagttgcttcttgttgtaaaatgaatttacttttaatttatacacaggcgtaaggatattaaggcgatgcatatgatgta |
288 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39187803 |
ccgagttttacatgaacaaggagttgcttcttgttgtaaaatgaatttacttttaatctatacacaggcgtatggatattaaggcgatgcatatgatgta |
39187704 |
T |
 |
| Q |
289 |
gtacattctcgcttctatgcaatacgttgtcaagttctggaccgtgcatatgatgtcaagttgaagtcagagcatggtttattttgtttgtctctctg |
386 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39187703 |
gtacattctcgcttctatgcaatacattgtcaagttctggaccgtgcatatgatgtcaagttgaagtcagagcatggtttattttgtttgtctctctg |
39187606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 5 - 160
Target Start/End: Complemental strand, 39187984 - 39187829
Alignment:
| Q |
5 |
gaggagcagagatatgtcaaggacttgaaggtttatattgatctgggaattgatggatgcaataggggattaaatgagaatgatgaacgaagaaatcaaa |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39187984 |
gaggagaagagatatgtcaaggacttgaaggtttatattgatctgggaattgatggatgcaataggggattaaatgagaatgatgaacgaagaaatcaaa |
39187885 |
T |
 |
| Q |
105 |
tttgtgaggtatggctgctgtatctcatcttatagaaaatcaattctcttgtttac |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39187884 |
tttgtgaggtatggctgctgtatctcatcttatagaaaatcaattctcttgtttac |
39187829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 159
Target Start/End: Complemental strand, 2889092 - 2889044
Alignment:
| Q |
111 |
aggtatggctgctgtatctcatcttatagaaaatcaattctcttgttta |
159 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
2889092 |
aggtatggctgctgtctcccatcttatagaaaatcacatctcttgttta |
2889044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 3145770 - 3145818
Alignment:
| Q |
111 |
aggtatggctgctgtatctcatcttatagaaaatcaattctcttgttta |
159 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
3145770 |
aggtatggctgctgtctcccatcttatagaaaatcacatctcttgttta |
3145818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University