View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_85 (Length: 394)
Name: NF1139_low_85
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 4e-57; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 257 - 385
Target Start/End: Complemental strand, 33051379 - 33051251
Alignment:
| Q |
257 |
tacatattttccaatataatctctcctatttatatgaaatcaacataacttagaagagattaatttcaattttaattaataaagaatatggtgatatata |
356 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33051379 |
tacatattttataatataatctctcctatttatatgaaatcaacataacttagaagagattaatttcaattttaattaataaagaatatggtgatatata |
33051280 |
T |
 |
| Q |
357 |
gttacgttgttaacacttcatatattatt |
385 |
Q |
| |
|
||||| |||||||||||||| |||||||| |
|
|
| T |
33051279 |
gttacattgttaacacttcagatattatt |
33051251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 145 - 236
Target Start/End: Complemental strand, 33051519 - 33051428
Alignment:
| Q |
145 |
gtaggtctagtaccctttatattctcttctaattgaaattttgctttgttttttcaaaaaatatatatgtgcaaatatattcgacttgcggt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33051519 |
gtaggtctagtaccctttatattctcttctaattggaattttgctttgttgtttcaaaaaatatatatgtgcaaatatattcgacttgcggt |
33051428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 33051665 - 33051601
Alignment:
| Q |
30 |
atttctgacaaagacaatgggacactgtcttttctataactggtgtgttaatctggactcgaggg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33051665 |
atttctgacaaagacaatgggacactgtcttttctataagtggtgtgttaatctggactcgaggg |
33051601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University