View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1139_low_89 (Length: 389)
Name: NF1139_low_89
Description: NF1139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1139_low_89 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 30 - 381
Target Start/End: Original strand, 32251326 - 32251677
Alignment:
| Q |
30 |
cagtaaggcttactttgcaactgcagagagtgtccgtgattcccttatcataaattggaatgcaacatatgaatattatgagagggttaatgttaagcaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32251326 |
cagtaaggcttactttgcaactgcagagagtgtccgtgattcccttatcataaattggaatgcaacatatgaatattatgagagggttaatgttaagcaa |
32251425 |
T |
 |
| Q |
130 |
gcttattacatgtctatggagtatctacaggttcatattgggtttcctttatgaaacacgggtcattttcattgcaaatgattattaattttcattacta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32251426 |
gcttattacatgtctatggagtatctacaggttcatattgggtttcctttatgaaacacgggtcattttcattgcaaatgattattaattttcattacta |
32251525 |
T |
 |
| Q |
230 |
cattttttcccaattgtgaagggtagggcattgttaaatgcaattgggaatttacaactctcaggtccttatgctgaggctctgaagaagctgggttaca |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32251526 |
cattttttcccaattgtgaagggtagggcattgttaaatgcaattgggaatttacaactctcaggtccttatgctgaggctctgaagaagctgggttaca |
32251625 |
T |
 |
| Q |
330 |
atttagaggatgtggctaatcaggttttttcctactattgttctcctttgtt |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32251626 |
atttagaggatgtggctaatcaggttttttcctactattgttctcctttgtt |
32251677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University