View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11400_high_34 (Length: 321)
Name: NF11400_high_34
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11400_high_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 16 - 316
Target Start/End: Original strand, 489841 - 490141
Alignment:
| Q |
16 |
gaaagaatccaattcccattgaaggagttcaagtttttgctttgtatttcagccaagccaagaagctcaaacttttctctccgtctgaaattgaagaaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
489841 |
gaaagaatccaattcccattgaaggagttcaagtttttgctttgtatttcagccaagccaagaagctgaaacttttctctccatctgaaattgaagaaat |
489940 |
T |
|
| Q |
116 |
ctctttggagccattcaactttgagcttataactgtttctccagtcactttatttcctaaaaagtccttgaagtttgctcctattggtttggttaacatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
489941 |
ctctttggagccattcaactttgagcttataactgtttctccagtcactttatttcctaaaaagtccttgaagtttgctcctattggtttggttaacatg |
490040 |
T |
|
| Q |
216 |
ctaaacaatggtggggcaattcagtcatttgaatatcttgaggctcaagatttggtgcaagttggaattagaggtgctggtgagatgagggtctctgctt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
490041 |
ctaaacaatggtggggcaattcagtcatttgaatatcttgaggctcaagatttggtgcaagttggaattagaggtgctggtgagatgagggtctatgctt |
490140 |
T |
|
| Q |
316 |
c |
316 |
Q |
| |
|
| |
|
|
| T |
490141 |
c |
490141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University