View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11400_high_4 (Length: 807)

Name: NF11400_high_4
Description: NF11400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11400_high_4
NF11400_high_4
[»] chr3 (1 HSPs)
chr3 (704-790)||(33628672-33628758)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 3e-41; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 3e-41
Query Start/End: Original strand, 704 - 790
Target Start/End: Original strand, 33628672 - 33628758
Alignment:
704 atctgagggtattttgaacattcttgttaagaggaaagaagaagaagaagcagtcattagtgatgtgctatatgttccttctatttc 790  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33628672 atctgagggtattttgaacattcttgttaagaggaaagaagaagaagaagcagtcattagtgatgtgctatatgttccttctatttc 33628758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University